Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311470

Morpholino Name: smad1 MO1
Synonyms: TEgg021o06, XtSmad1
mRNA Target: smad1

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGAATAAGCTTGTCACATTCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' CAATGAATGTGACAAGCTTATTCTC 3' ||||||||||||||||||||||||| 3' GTTACTTACACTGTTCGAATAAGAG 5' 5' CAATGAATGTGACAAGCCTTTTCTC 3' ||||||||||||||||| | ||||| 3' GTTACTTACACTGTTCGAATAAGAG 5' 5' CAATGAATGTGACGAGCTTGTTCTC 3' ||||||||||||| ||||| ||||| 3' GTTACTTACACTGTTCGAATAAGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:51672494..51672518 23/25 Antisense target smad1.L
chr1S:47011900..47011924 23/25 Antisense target smad1.S
chr6S:36237622..36237646 21/25 unknown
tropicalis 10.0 Chr1:58613789..58613813 25/25 Antisense target smad1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers