Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311471

Morpholino Name: smad4.2 MO3
Synonyms: Smad10, TEgg032k01, XtSmad10
mRNA Target: smad4.2

Morpholino Type:
Sequence:
5' AGCTCCAGGCTGGCAAACGCCATCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AGATGGCGTTTGCCAGCCTAGAGCT 3' ||||||||||||||||||| ||||| 3' TCTACCGCAAACGGTCGGACCTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12462:534418-534442 24/25 Antisense target smad4.2.S
Scaffold46492:1056347-1056371 24/25 Antisense off-target Xelaev16056201m
Scaffold27036:976776-976800 22/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556