Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311472

Morpholino Name: smad2 MO3
Synonyms: TEgg118f13, XtSmad2
mRNA Target: smad2

Morpholino Type:
Sequence:
5' GGTAAATGGCAAAATGGAGGACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' CATGTCCTCGATTTTGCCATTCACC 3' ||||||||| ||||||||||| ||| 3' GTACAGGAGGTAAAACGGTAAATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold40963:1480364-1480388 23/25 Antisense target smad2.S
Scaffold102974:18529928-18529952 22/25 Sense off-target Xelaev16000912m
Scaffold139752:321275-321299 21/25 Antisense off-target Xelaev16012476m
Scaffold243:3802306-3802330 21/25 unknown
Scaffold287959:2247180-2247204 21/25 unknown
Scaffold28814:68092-68116 21/25 unknown
Scaffold3490:1446224-1446248 21/25 Antisense off-target Xelaev16045906m
tropicalis 7.1 scaffold_1:6382168-6382192 25/25 Antisense off-target smad3
scaffold_3:113566674-113566698 22/25 unknown
scaffold_1:58569665-58569689 21/25 unknown
scaffold_1:77958215-77958239 21/25 unknown
scaffold_3:73559944-73559968 21/25 unknown
scaffold_8:28507832-28507856 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556