Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311472

Morpholino Name: smad2 MO3
Synonyms: TEgg118f13, XtSmad2
Target mRNA: smad2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTAAATGGCAAAATGGAGGACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CATGTCCTCCATTTTGCCATTTACC 3' ||||||||||||||||||||||||| 3' GTACAGGAGGTAAAACGGTAAATGG 5' 5' CATGTCCTCGATTTTGCCATTCACC 3' ||||||||| ||||||||||| ||| 3' GTACAGGAGGTAAAACGGTAAATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:174261550..174261574 23/25 Antisense target smad2.S
chr5L:3727767..3727791 22/25 Sense off-target LOC108716082 [provisional:nrxn1]
Scaffold26:719558..719582 21/25 Sense off-target helq.S
chr2S:52258205..52258229 21/25 Antisense off-target nfasc.S
chr9_10L:44048485..44048509 21/25 Antisense off-target ern1.L
chr1L:65442400..65442424 21/25 unknown
chr7L:72815128..72815152 21/25 unknown
tropicalis 10.0 Chr1:206106105..206106129 25/25 Antisense target smad2
Chr3:85189233..85189257 22/25 unknown
Chr1:149413881..149413905 21/25 unknown
Chr2:61332987..61333011 21/25 unknown
Chr3:45091282..45091306 21/25 unknown
Chr8:50328827..50328851 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers