Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311473

Morpholino Name: smad3 MO1
Synonyms: TNeu050m05, Xtsmad3
mRNA Target: smad3

Morpholino Type:
Sequence:
5' AAGGGAAGAATCGAGGACATGACAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36401:3693890..3693914 24/25 Antisense off-target Xelaev16047538m
Scaffold58049:4898631..4898655 23/25 Antisense off-target Xelaev16063783m
Scaffold19259:280150..280174 22/25 unknown
Scaffold36134:1208969..1208993 22/25 unknown
Scaffold78337:240910..240934 22/25 unknown
Scaffold169907:3208567..3208591 21/25 unknown
Scaffold27036:10240600..10240624 21/25 unknown
tropicalis 7.1 scaffold_3:32277367..32277391 25/25 unknown
scaffold_6:99582839..99582863 22/25 unknown
scaffold_3:12041266..12041290 21/25 Antisense off-target ggcx
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556