Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311474

Morpholino Name: smad4.1 MO2
Synonyms: TNeu052c18, XtSmad4, XtSmad4a
mRNA Target: smad4.1

Morpholino Type:
Sequence:
5' TGTTTGTGATGCACATGGTGTCGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 21/25
genomic

MO
5' GCCGACACCATGTCCATCACAAACA 3' ||||||||||||| ||||||||||| 3' CGGCTGTGGTACACGTAGTGTTTGT 5' 5' ACCGACAATATGTCCATCACAAACA 3' |||||| |||| ||||||||||| 3' CGGCTGTGGTACACGTAGTGTTTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold143831:367260-367284 21/25 Antisense target smad4.1.L
tropicalis 7.1 scaffold_1:4924169-4924193 24/25 Antisense target smad4.1
scaffold_1:15975951-15975975 21/25 Sense off-target homer1
scaffold_8:36571878-36571902 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556