Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311475

Morpholino Name: smad6 MO2
Synonyms: TGas073h08, XtSmad6
mRNA Target: smad6

Morpholino Type: uncategorized morpholino
Sequence:
5' CCGGTGCGTCTGGACCTGAACATGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' GCATGTTCAGGTCCAGACGCACCGG 3' ||||||||||||||||||||||||| 3' CGTACAAGTCCAGGTCTGCGTGGCC 5' 5' GCATGTTCAGGTCCAGACGCACGGG 3' |||||||||||||||||||||| || 3' CGTACAAGTCCAGGTCTGCGTGGCC 5' 5' GCATGTTCAGGTCCAGACGCGCGGG 3' |||||||||||||||||||| | || 3' CGTACAAGTCCAGGTCTGCGTGGCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:108422230..108422254 24/25 Antisense target smad6.L
chr3S:35752821..35752845 23/25 Antisense target smad6.S
chr7L:46510927..46510951 21/25 unknown
tropicalis 10.0 Chr3:117263864..117263888 25/25 Antisense target smad6
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers