Morpholino: smad7 MO3

Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary

XB-MORPHOLINO-17311476

Morpholino Name: smad7 MO3
Synonyms: TNeu095k24, Xtsmad7
mRNA Target: smad7

Morpholino Type: uncategorized morpholino
Sequence:
5' GATCGTTTGGTCCTGAACATGCGGG 3'

Source: Gene Tools LLC

mRNA Target	tropicalis	laevis.L		laevis.S
Identities	25/25	25/25		25/25
genomic MO	5' CCCGCATGTTCAGGACCAAACGATC 3' \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| 3' GGGCGTACAAGTCCTGGTTTGCTAG 5'	5' CCCGCATGTTCAGGACCAAACGATC 3' \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| 3' GGGCGTACAAGTCCTGGTTTGCTAG 5'		5' CCCGCATGTTCAGGACCAAACGATC 3' \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| 3' GGGCGTACAAGTCCTGGTTTGCTAG 5'
Genomic Alignments	Position	Identity	Strand	Target	mRNA
laevis 9.2	chr1L:210129730..210129754	25/25	Antisense	target	smad7.L
	chr1S:173735626..173735650	25/25	Antisense	target	smad7.S
	View All (2)
tropicalis 10.0	Chr1:205595792..205595816	25/25	Antisense	target	smad7
	Chr1:205595792..205595816	25/25	Antisense	off-target	Xetrov107008403m.g
	View All (2)
Publications
First:	Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006
Most recent:
	View All Papers