Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311483

Morpholino Name: tgif1 MO1
Synonyms: TNeu055p01, XtTALElike
Target mRNA: tgif1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCTTTCTTGGCTTTCATACTAGCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 21/25 21/25
genomic

MO
5' CGCTAGTATGAAAGCCAAGAAAGGT 3' |||||||||||||||||||||||| 3' GCGATCATACTTTCGGTTCTTTCCG 5' 5' TGCTACAATGAAAGCCAAGAAAGGT 3' |||| ||||||||||||||||| 3' GCGATCATACTTTCGGTTCTTTCCG 5' 5' TGCTACAATGAAAGCCAAGAAAGGT 3' |||| ||||||||||||||||| 3' GCGATCATACTTTCGGTTCTTTCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:106635677..106635701 21/25 Antisense target tgif1.L
chr6S:84357455..84357479 21/25 Antisense target tgif1.S
chr1S:74663976..74664000 21/25 Antisense off-target adgrl3.S
chr5L:89396621..89396645 21/25 Sense off-target me1.L
chr6L:132451084..132451108 21/25 Antisense off-target ncald.L
chr6L:64272299..64272323 21/25 unknown
tropicalis 10.0 Chr6:106896162..106896186 24/25 Antisense target tgif1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers