Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311484

Morpholino Name: tgif2 MO3
Synonyms: TNeu131c18, XtTALElike2
mRNA Target: tgif2

Morpholino Type:
Sequence:
5' ATTCATCATTCTCCAATGCTCCCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 6/26
genomic

MO
5' CAGGGAGCATTGGAGAATGATGAAT 3' || | | | | 3' TCCCTCGTAACCTCTTACTACTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold120166:59999..60023 22/25 Sense off-target Xelaev16005157m
Scaffold20641:1870665..1870689 22/25 Antisense off-target Xelaev16026596m
Scaffold36364:7903002..7903026 21/25 unknown
Scaffold80536:800421..800445 21/25 unknown
tropicalis 7.1 scaffold_10:9700396..9700420 25/25 Antisense target tgif2
scaffold_1:185173881..185173905 21/25 Antisense off-target corin
scaffold_3:68136099..68136123 21/25 unknown
scaffold_6:109580652..109580676 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556