Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311487

Morpholino Name: tbx3 MO1
Synonyms: TTpA012g23, Xttbx3
mRNA Target: tbx3

Morpholino Type:
Sequence:
5' CTGGATCTCTCATGGGTAAATTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' ATGAATTTACCCATGAGAGATCCAG 3' ||||||||||||||||||||||||| 3' TACTTAAATGGGTACTCTCTAGGTC 5' 5' ATGAATTTACCCATGAGAGATCCAG 3' ||||||||||||||||||||||||| 3' TACTTAAATGGGTACTCTCTAGGTC 5' 5' ATGAATTTACCCATGAGAGACCCAG 3' |||||||||||||||||||| |||| 3' TACTTAAATGGGTACTCTCTAGGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold229342:650424-650448 25/25 Antisense target tbx3.L
Scaffold44061:1134737-1134761 24/25 Antisense target tbx3.S
tropicalis 7.1 scaffold_1:62142281-62142305 25/25 Antisense target tbx3
scaffold_10:25661630-25661654 21/25 Antisense off-target cdh22
scaffold_5:92806493-92806517 21/25 unknown
scaffold_7:67220387-67220411 21/25 Antisense off-target nxpe2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556