Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311488

Morpholino Name: tbx3 MO2
Synonyms: TTpA012g23, Xttbx3.2
mRNA Target: tbx3

Morpholino Type:
Sequence:
5' TCACTTGCACCCTTTGGATCTCACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' TGTGAGATCCAAAGGGTGCAAGTGA 3' ||||||||||||||||||||||||| 3' ACACTCTAGGTTTCCCACGTTCACT 5' 5' GGTGACATCCAAAGGGTGCAAGTGA 3' |||| ||||||||||||||||||| 3' ACACTCTAGGTTTCCCACGTTCACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold44061:1134712-1134736 23/25 Antisense target tbx3.S
Scaffold86352:382939-382963 23/25 unknown
Scaffold139741:408752-408776 22/25 Antisense off-target Xelaev16012387m
Scaffold81941:1908962-1908986 22/25 unknown
Scaffold23872:5197956-5197980 21/25 Sense off-target Xelaev16031770m
Scaffold52341:1102334-1102358 21/25 unknown
tropicalis 7.1 scaffold_1:62142306-62142330 25/25 Antisense target tbx3
scaffold_1:195471132-195471156 21/25 Sense off-target trmt44
scaffold_4:73532934-73532958 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556