Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311488

Morpholino Name: tbx3 MO2
Synonyms: TTpA012g23, Xttbx3.2
Target mRNA: tbx3

Morpholino Type: uncategorized morpholino
Sequence: 5' TCACTTGCACCCTTTGGATCTCACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' TGTGAGATCCAAAGGGTGCAAGTGA 3' ||||||||||||||||||||||||| 3' ACACTCTAGGTTTCCCACGTTCACT 5' 5' GGTGACATCCAAAGGGTGCAAGTGA 3' |||| ||||||||||||||||||| 3' ACACTCTAGGTTTCCCACGTTCACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:119199157..119199181 23/25 Antisense target tbx3.S
chr2S:157610429..157610453 23/25 Sense off-target pde2a.S
chr3L:122769143..122769167 22/25 Antisense off-target sorbs3.L
chr3S:42445066..42445090 21/25 Sense off-target LOC108712840 [provisional:ntrk3]
chr9_10L:40872788..40872812 22/25 unknown
chr7L:100257853..100257877 21/25 unknown
tropicalis 10.0 Chr1:145775715..145775739 25/25 Antisense target tbx3
Chr1:24095974..24095998 21/25 Sense off-target trmt44
Chr4:121088473..121088497 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers