Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311491

Morpholino Name: dynlt1 MO1
Synonyms: TCTEX1, TNeu139i18, XtTCTEX-1
mRNA Target: dynlt1

Morpholino Type:
Sequence:
5' CCTCTGCCGTTTGAAATTCATCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGATGAATTTCAAACGGCAGAGG 3' ||||||||||||||||||||||||| 3' TACCTACTTAAAGTTTGCCGTCTCC 5' 5' ATGGATGAATTTCAAACGGCAGAGG 3' ||||||||||||||||||||||||| 3' TACCTACTTAAAGTTTGCCGTCTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold135448:24842-24866 25/25 Antisense target dynlt1.L
Scaffold88892:671216-671240 21/25 Antisense off-target Xelaev16077544m
tropicalis 7.1 scaffold_5:65178899-65178923 25/25 Antisense target dynlt1
scaffold_4:94708933-94708957 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556