Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311498

Morpholino Name: vegt MO10
Synonyms: TEgg048b09, XtVegT1.2
mRNA Target: vegt

Morpholino Type:
Sequence:
5' TGTGTTCCTGACAGCAGTTTCTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 21/25 21/25
genomic

MO
5' ATGAGAAACTGCTGTCAGGAACACA 3' ||||||||||||||||||||||||| 3' TACTCTTTGACGACAGTCCTTGTGT 5' 5' ATGAGAAACTGCTGTCGGGAATGCG 3' |||||||||||||||| |||| | 3' TACTCTTTGACGACAGTCCTTGTGT 5' 5' ATGAGAAACTGCTGTCGGGAACGTG 3' |||||||||||||||| ||||| 3' TACTCTTTGACGACAGTCCTTGTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold120240:178352-178376 21/25 Antisense off-target Xelaev16005496m
Scaffold133644:1911745-1911769 21/25 unknown
Scaffold162663:567781-567805 21/25 Antisense target vegt.L
Scaffold388188:2313-2337 21/25 unknown
Scaffold97703:133799-133823 21/25 Antisense target vegt.S
tropicalis 7.1 scaffold_1:55047289-55047313 25/25 Antisense target vegt
scaffold_3:12133395-12133419 21/25 Sense off-target h2afz
scaffold_3:12133395-12133419 21/25 Antisense off-target polm
scaffold_8:27212572-27212596 21/25 Antisense off-target dcx
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556