Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311499

Morpholino Name: wnt11b MO5
Synonyms: TGas144p20, Xtwnt11
mRNA Target: wnt11b

Morpholino Type: uncategorized morpholino
Sequence:
5' TGGATCTGAGCCATTGCTAGTGCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold20085:91..115 22/25 unknown
Scaffold5925:896207..896231 22/25 unknown
tropicalis 7.1 scaffold_8:24210705..24210729 25/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556