Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311501

Morpholino Name: wnt5b MO1
Synonyms: TGas012b13, Xtwnt5c
mRNA Target: wnt5b

Morpholino Type:
Sequence:
5' CAGTAGTCGCAGAATTCCCGTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' CATGACGGGAATTCTGCGACTACTG 3' ||||||||||||||||||||||||| 3' GTACTGCCCTTAAGACGCTGATGAC 5' 5' CATGACGCCAATTCTGCGACTTCTC 3' ||||||| |||||||||||| || 3' GTACTGCCCTTAAGACGCTGATGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold256647:493153..493177 21/25 Antisense target wnt5b.S
Scaffold58790:818897..818921 21/25 Antisense off-target Xelaev16064073m
tropicalis 7.1 scaffold_3:40742455..40742479 25/25 Antisense target wnt5b
scaffold_9085:438..462 25/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556