Morpholino: wnt5b MO1

Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary

XB-MORPHOLINO-17311501

Morpholino Name: wnt5b MO1
Synonyms: TGas012b13, Xtwnt5c
mRNA Target: wnt5b

Morpholino Type: uncategorized morpholino
Sequence:
5' CAGTAGTCGCAGAATTCCCGTCATG 3'

Source: Gene Tools LLC

mRNA Target	tropicalis	laevis.L		laevis.S
Identities	25/25	21/25		21/25
genomic MO	5' CATGACGGGAATTCTGCGACTACTG 3' \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| 3' GTACTGCCCTTAAGACGCTGATGAC 5'	5' CATGACGCCAATTCTGCGACTTCTC 3' \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\| 3' GTACTGCCCTTAAGACGCTGATGAC 5'		5' CATGACGCCAATTCTGCGACTTCTC 3' \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\| 3' GTACTGCCCTTAAGACGCTGATGAC 5'
Genomic Alignments	Position	Identity	Strand	Target	mRNA
laevis 9.2	Scaffold39:1197561..1197585	21/25	Antisense	target	wnt5b.L
	chr3S:5757050..5757074	21/25	Antisense	target	wnt5b.S
	View All (2)
tropicalis 10.0	Chr3:9386048..9386072	25/25	Antisense	target	wnt5b
	View All (1)
Publications
First:	Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006
Most recent:
	View All Papers