Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311502

Morpholino Name: wnt5b MO2
Synonyms: TGas012b13, Xtwnt5c.2
mRNA Target: wnt5b

Morpholino Type:
Sequence:
5' AATTCCCGTCATGCTGCTCCTCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GGAGAGGAGCAGCATGACGGGAATT 3' ||||||||||||||||||||||||| 3' CCTCTCCTCGTCGTACTGCCCTTAA 5' 5' GGAGAGGAGCAACATGACGCCAATT 3' ||||||||||| ||||||| |||| 3' CCTCTCCTCGTCGTACTGCCCTTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold58790:818885-818909 23/25 Antisense off-target Xelaev16064073m
Scaffold256647:493165-493189 22/25 Antisense target wnt5b.S
Scaffold43394:269161-269185 22/25 unknown
Scaffold149581:3541748-3541772 21/25 unknown
Scaffold149890:2450688-2450712 21/25 unknown
Scaffold15436:1616758-1616782 21/25 Antisense off-target Xelaev16015670m
Scaffold166674:4178178-4178202 21/25 Sense off-target arhgap32.L
Scaffold229323:100711-100735 21/25 unknown
Scaffold337825:1249916-1249940 21/25 Sense off-target Xelaev16044455m
Scaffold36401:329131-329155 21/25 unknown
Scaffold39604:528719-528743 21/25 Sense off-target Xelaev16050327m
Scaffold52441:4065323-4065347 21/25 unknown
Scaffold57559:1823922-1823946 21/25 Antisense off-target Xelaev16063384m
Scaffold68717:2078216-2078240 21/25 unknown
Scaffold8006:2322183-2322207 21/25 unknown
Scaffold8630:1984517-1984541 21/25 unknown
Scaffold8834:2980353-2980377 21/25 unknown
tropicalis 7.1 scaffold_3:40742467-40742491 25/25 Antisense target wnt5b
scaffold_9085:450-474 25/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556