Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311505

Morpholino Name: zfp160 MO1
Synonyms: ARP2/3 1a, TNeu074i11, Xtznfp1, znf287, znf527
mRNA Target: zfp160

Morpholino Type:
Sequence:
5' CACTCGCTTCCTCCCACATTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGGAATGTGGGAGGAAGCGAGTG 3' ||||||||||||||||||||||||| 3' TACCCTTACACCCTCCTTCGCTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold162806:4355-4379 25/25 Antisense off-target Xelaev16018089m
Scaffold197913:636732-636756 25/25 Antisense off-target Xelaev16025155m
Scaffold368247:7-31 25/25 unknown
Scaffold45548:116639-116663 25/25 Antisense off-target Xelaev16055149m
Scaffold74488:1309274-1309298 25/25 Antisense off-target Xelaev16071283m
Scaffold11418:270020-270044 24/25 Antisense off-target Xelaev16004005m
Scaffold58936:662-686 24/25 unknown
Scaffold379636:61-85 23/25 unknown
Scaffold5567:15-39 23/25 unknown
Scaffold187471:1314-1338 22/25 unknown
Scaffold120240:7121110-7121134 21/25 Sense off-target Xelaev16005779m
Scaffold160841:4089865-4089889 21/25 Sense off-target Xelaev16017575m
Scaffold251007:671551-671575 21/25 unknown
Scaffold251883:380674-380698 21/25 Antisense off-target Xelaev16033533m
Scaffold8006:101746-101770 21/25 unknown
tropicalis 7.1 scaffold_8c:3102944-3102968 25/25 Antisense off-target znf567
scaffold_8c:3114914-3114938 25/25 Antisense off-target znf567
scaffold_1245:11634-11658 25/25 Antisense off-target LOC100488224
scaffold_2639:5161-5185 25/25 Antisense off-target LOC100488817
scaffold_302:46433-46457 25/25 unknown
scaffold_4:81607626-81607650 25/25 unknown
scaffold_4:81618177-81618201 25/25 unknown
scaffold_4:81630476-81630500 25/25 unknown
scaffold_4:81694041-81694065 25/25 unknown
scaffold_4:81713826-81713850 25/25 unknown
scaffold_4:81721164-81721188 25/25 unknown
scaffold_4:81731227-81731251 25/25 unknown
scaffold_4:81748009-81748033 25/25 unknown
scaffold_4:81756833-81756857 25/25 Antisense off-target znf234
scaffold_4:81762379-81762403 25/25 unknown
scaffold_4:81990816-81990840 25/25 unknown
scaffold_4:82001101-82001125 25/25 unknown
scaffold_4:82050402-82050426 25/25 unknown
scaffold_4:82057009-82057033 25/25 Antisense off-target znf432
scaffold_4:82057009-82057033 25/25 Antisense off-target znf853
scaffold_4:82070903-82070927 25/25 Antisense off-target znf853
scaffold_4:82077870-82077894 25/25 Antisense off-target znf853
scaffold_4:82083858-82083882 25/25 Antisense off-target znf853
scaffold_4:82091651-82091675 25/25 Antisense off-target znf853
scaffold_364:95878-95902 25/25 unknown
scaffold_4:82110605-82110629 25/25 unknown
scaffold_4:82146770-82146794 25/25 unknown
scaffold_4:82156662-82156686 25/25 unknown
scaffold_4:82168025-82168049 25/25 unknown
scaffold_4:82174090-82174114 25/25 unknown
scaffold_4:82179785-82179809 25/25 unknown
scaffold_4:82233911-82233935 25/25 unknown
scaffold_4:82244196-82244220 25/25 Antisense off-target znf805
scaffold_4:82261208-82261232 25/25 unknown
scaffold_4:82271698-82271722 25/25 unknown
scaffold_4:82296703-82296727 25/25 unknown
scaffold_4:82302858-82302882 25/25 unknown
scaffold_4:82332631-82332655 25/25 unknown
scaffold_4:82351587-82351611 25/25 unknown
scaffold_4:82377205-82377229 25/25 unknown
scaffold_4:82382443-82382467 25/25 unknown
scaffold_4:82411781-82411805 25/25 Antisense off-target znf721
scaffold_4:82100435-82100459 25/25 unknown
scaffold_4:82426275-82426299 25/25 unknown
scaffold_4:82437129-82437153 25/25 unknown
scaffold_4:82438169-82438193 25/25 unknown
scaffold_4:82443722-82443746 25/25 unknown
scaffold_4:82457864-82457888 25/25 unknown
scaffold_4:82460171-82460195 25/25 unknown
scaffold_4:82476142-82476166 25/25 unknown
scaffold_4:82478349-82478373 25/25 unknown
scaffold_4:82511161-82511185 25/25 unknown
scaffold_4:82523136-82523160 25/25 unknown
scaffold_4:82532720-82532744 25/25 unknown
scaffold_4:82534578-82534602 25/25 unknown
scaffold_4:82552169-82552193 25/25 unknown
scaffold_4:82555086-82555110 25/25 Antisense off-target unnamed
scaffold_4:82555086-82555110 25/25 Antisense off-target znf546
scaffold_4:82571220-82571244 25/25 Sense off-target unnamed
scaffold_4:82576921-82576945 25/25 Antisense off-target unnamed
scaffold_4:82584770-82584794 25/25 unknown
scaffold_4:82594619-82594643 25/25 unknown
scaffold_4:82604116-82604140 25/25 unknown
scaffold_4:82423924-82423948 25/25 Antisense off-target znf721
scaffold_425:18235-18259 25/25 unknown
scaffold_425:48295-48319 25/25 unknown
scaffold_425:62120-62144 25/25 unknown
scaffold_425:8839-8863 25/25 unknown
scaffold_44:104220-104244 25/25 unknown
scaffold_44:114486-114510 25/25 unknown
scaffold_44:11623-11647 25/25 Antisense off-target zfp2
scaffold_44:125193-125217 25/25 unknown
scaffold_44:140086-140110 25/25 unknown
scaffold_44:142891-142915 25/25 unknown
scaffold_44:168795-168819 25/25 unknown
scaffold_44:204124-204148 25/25 unknown
scaffold_44:211819-211843 25/25 unknown
scaffold_44:220197-220221 25/25 unknown
scaffold_44:234362-234386 25/25 unknown
scaffold_44:24761-24785 25/25 Antisense off-target zfp2
scaffold_44:252135-252159 25/25 unknown
scaffold_44:266637-266661 25/25 Antisense off-target xlcof22
scaffold_44:277028-277052 25/25 unknown
scaffold_44:293847-293871 25/25 unknown
scaffold_4:82626236-82626260 25/25 unknown
scaffold_44:318964-318988 25/25 unknown
scaffold_44:341136-341160 25/25 unknown
scaffold_44:353029-353053 25/25 unknown
scaffold_44:360332-360356 25/25 unknown
scaffold_44:370047-370071 25/25 unknown
scaffold_44:385000-385024 25/25 unknown
scaffold_44:395170-395194 25/25 unknown
scaffold_44:401362-401386 25/25 unknown
scaffold_44:410138-410162 25/25 unknown
scaffold_44:419910-419934 25/25 unknown
scaffold_44:431753-431777 25/25 unknown
scaffold_44:440349-440373 25/25 unknown
scaffold_44:459683-459707 25/25 unknown
scaffold_44:46108-46132 25/25 Antisense off-target zfp2
scaffold_44:468537-468561 25/25 unknown
scaffold_44:473115-473139 25/25 unknown
scaffold_44:479727-479751 25/25 unknown
scaffold_44:488127-488151 25/25 Antisense off-target znf717
scaffold_44:497598-497622 25/25 unknown
scaffold_44:506409-506433 25/25 unknown
scaffold_44:305867-305891 25/25 unknown
scaffold_44:530591-530615 25/25 unknown
scaffold_44:537801-537825 25/25 unknown
scaffold_44:546818-546842 25/25 Antisense off-target zfp160
scaffold_44:560635-560659 25/25 Antisense off-target zfp160
scaffold_44:572868-572892 25/25 unknown
scaffold_44:579433-579457 25/25 unknown
scaffold_44:592463-592487 25/25 unknown
scaffold_44:59713-59737 25/25 Antisense off-target znf782
scaffold_44:610467-610491 25/25 unknown
scaffold_44:622737-622761 25/25 unknown
scaffold_44:631155-631179 25/25 unknown
scaffold_44:642485-642509 25/25 unknown
scaffold_44:653473-653497 25/25 unknown
scaffold_44:88025-88049 25/25 unknown
scaffold_4525:3264-3288 25/25 unknown
scaffold_4883:3241-3265 25/25 unknown
scaffold_497:21610-21634 25/25 unknown
scaffold_497:39601-39625 25/25 unknown
scaffold_525:21694-21718 25/25 Antisense target znf287
scaffold_44:516177-516201 25/25 unknown
scaffold_525:361-385 25/25 unknown
scaffold_525:43741-43765 25/25 Antisense target znf287
scaffold_525:53368-53392 25/25 Antisense target znf287
scaffold_5320:3179-3203 25/25 unknown
scaffold_5320:791-815 25/25 unknown
scaffold_659:17896-17920 25/25 unknown
scaffold_659:1855-1879 25/25 unknown
scaffold_659:34026-34050 25/25 unknown
scaffold_659:35722-35746 25/25 unknown
scaffold_680:12120-12144 25/25 Antisense off-target LOC100495155
scaffold_680:21500-21524 25/25 Antisense off-target LOC100495155
scaffold_684:25721-25745 25/25 unknown
scaffold_684:8489-8513 25/25 unknown
scaffold_6929:585-609 25/25 unknown
scaffold_6965:877-901 25/25 unknown
scaffold_6982:214-238 25/25 unknown
scaffold_7:9215231-9215255 25/25 unknown
scaffold_8431:3201-3225 25/25 unknown
scaffold_8c:3072594-3072618 25/25 Antisense off-target zscan29
scaffold_8c:3091216-3091240 25/25 Antisense off-target znf567
scaffold_525:33906-33930 25/25 Antisense target znf287
scaffold_4:81979702-81979726 24/25 unknown
scaffold_4:82220918-82220942 24/25 unknown
scaffold_44:599603-599627 24/25 unknown
scaffold_1:72753501-72753525 22/25 Antisense off-target sox13
scaffold_4:82251124-82251148 22/25 unknown
scaffold_1:196466473-196466497 21/25 Sense off-target bod1l1
scaffold_4:82223320-82223344 21/25 unknown
Publications
First:
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556