Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311505

Morpholino Name: zfp160 MO1
Synonyms: ARP2/3 1a, TNeu074i11, Xtznfp1, znf287, znf527
mRNA Target: zfp160

Morpholino Type:
Sequence:
5' CACTCGCTTCCTCCCACATTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGGAATGTGGGAGGAAGCGAGTG 3' ||||||||||||||||||||||||| 3' TACCCTTACACCCTCCTTCGCTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold162806:4355..4379 25/25 Antisense off-target Xelaev16018089m
Scaffold197913:636732..636756 25/25 Antisense off-target Xelaev16025155m
Scaffold368247:7..31 25/25 unknown
Scaffold45548:116639..116663 25/25 Antisense off-target Xelaev16055149m
Scaffold74488:1309274..1309298 25/25 Antisense off-target Xelaev16071283m
Scaffold11418:270020..270044 24/25 Antisense off-target Xelaev16004005m
Scaffold58936:662..686 24/25 unknown
Scaffold379636:61..85 23/25 unknown
Scaffold5567:15..39 23/25 unknown
Scaffold187471:1314..1338 22/25 unknown
Scaffold120240:7121110..7121134 21/25 Sense off-target Xelaev16005779m
Scaffold160841:4089865..4089889 21/25 Sense off-target Xelaev16017575m
Scaffold251007:671551..671575 21/25 unknown
Scaffold251883:380674..380698 21/25 Antisense off-target Xelaev16033533m
Scaffold8006:101746..101770 21/25 unknown
tropicalis 7.1 scaffold_8c:3102944..3102968 25/25 Antisense off-target znf567
scaffold_8c:3114914..3114938 25/25 Antisense off-target znf567
scaffold_1245:11634..11658 25/25 Antisense off-target LOC100488224
scaffold_2639:5161..5185 25/25 Antisense off-target LOC100488817
scaffold_302:46433..46457 25/25 unknown
scaffold_4:81607626..81607650 25/25 unknown
scaffold_4:81618177..81618201 25/25 unknown
scaffold_4:81630476..81630500 25/25 unknown
scaffold_4:81694041..81694065 25/25 unknown
scaffold_4:81713826..81713850 25/25 unknown
scaffold_4:81721164..81721188 25/25 unknown
scaffold_4:81731227..81731251 25/25 unknown
scaffold_4:81748009..81748033 25/25 unknown
scaffold_4:81756833..81756857 25/25 Antisense off-target znf234
scaffold_4:81762379..81762403 25/25 unknown
scaffold_4:81990816..81990840 25/25 unknown
scaffold_4:82001101..82001125 25/25 unknown
scaffold_4:82050402..82050426 25/25 unknown
scaffold_4:82057009..82057033 25/25 Antisense off-target znf432
scaffold_4:82057009..82057033 25/25 Antisense off-target znf853
scaffold_4:82070903..82070927 25/25 Antisense off-target znf853
scaffold_4:82077870..82077894 25/25 Antisense off-target znf853
scaffold_4:82083858..82083882 25/25 Antisense off-target znf853
scaffold_4:82091651..82091675 25/25 Antisense off-target znf853
scaffold_364:95878..95902 25/25 unknown
scaffold_4:82110605..82110629 25/25 unknown
scaffold_4:82146770..82146794 25/25 unknown
scaffold_4:82156662..82156686 25/25 unknown
scaffold_4:82168025..82168049 25/25 unknown
scaffold_4:82174090..82174114 25/25 unknown
scaffold_4:82179785..82179809 25/25 unknown
scaffold_4:82233911..82233935 25/25 unknown
scaffold_4:82244196..82244220 25/25 Antisense off-target znf805
scaffold_4:82261208..82261232 25/25 unknown
scaffold_4:82271698..82271722 25/25 unknown
scaffold_4:82296703..82296727 25/25 unknown
scaffold_4:82302858..82302882 25/25 unknown
scaffold_4:82332631..82332655 25/25 unknown
scaffold_4:82351587..82351611 25/25 unknown
scaffold_4:82377205..82377229 25/25 unknown
scaffold_4:82382443..82382467 25/25 unknown
scaffold_4:82411781..82411805 25/25 Antisense off-target znf721
scaffold_4:82100435..82100459 25/25 unknown
scaffold_4:82426275..82426299 25/25 unknown
scaffold_4:82437129..82437153 25/25 unknown
scaffold_4:82438169..82438193 25/25 unknown
scaffold_4:82443722..82443746 25/25 unknown
scaffold_4:82457864..82457888 25/25 unknown
scaffold_4:82460171..82460195 25/25 unknown
scaffold_4:82476142..82476166 25/25 unknown
scaffold_4:82478349..82478373 25/25 unknown
scaffold_4:82511161..82511185 25/25 unknown
scaffold_4:82523136..82523160 25/25 unknown
scaffold_4:82532720..82532744 25/25 unknown
scaffold_4:82534578..82534602 25/25 unknown
scaffold_4:82552169..82552193 25/25 unknown
scaffold_4:82555086..82555110 25/25 Antisense off-target unnamed
scaffold_4:82555086..82555110 25/25 Antisense off-target znf546
scaffold_4:82571220..82571244 25/25 Sense off-target unnamed
scaffold_4:82576921..82576945 25/25 Antisense off-target unnamed
scaffold_4:82584770..82584794 25/25 unknown
scaffold_4:82594619..82594643 25/25 unknown
scaffold_4:82604116..82604140 25/25 unknown
scaffold_4:82423924..82423948 25/25 Antisense off-target znf721
scaffold_425:18235..18259 25/25 unknown
scaffold_425:48295..48319 25/25 unknown
scaffold_425:62120..62144 25/25 unknown
scaffold_425:8839..8863 25/25 unknown
scaffold_44:104220..104244 25/25 unknown
scaffold_44:114486..114510 25/25 unknown
scaffold_44:11623..11647 25/25 Antisense off-target zfp2
scaffold_44:125193..125217 25/25 unknown
scaffold_44:140086..140110 25/25 unknown
scaffold_44:142891..142915 25/25 unknown
scaffold_44:168795..168819 25/25 unknown
scaffold_44:204124..204148 25/25 unknown
scaffold_44:211819..211843 25/25 unknown
scaffold_44:220197..220221 25/25 unknown
scaffold_44:234362..234386 25/25 unknown
scaffold_44:24761..24785 25/25 Antisense off-target zfp2
scaffold_44:252135..252159 25/25 unknown
scaffold_44:266637..266661 25/25 Antisense off-target xlcof22
scaffold_44:277028..277052 25/25 unknown
scaffold_44:293847..293871 25/25 unknown
scaffold_4:82626236..82626260 25/25 unknown
scaffold_44:318964..318988 25/25 unknown
scaffold_44:341136..341160 25/25 unknown
scaffold_44:353029..353053 25/25 unknown
scaffold_44:360332..360356 25/25 unknown
scaffold_44:370047..370071 25/25 unknown
scaffold_44:385000..385024 25/25 unknown
scaffold_44:395170..395194 25/25 unknown
scaffold_44:401362..401386 25/25 unknown
scaffold_44:410138..410162 25/25 unknown
scaffold_44:419910..419934 25/25 unknown
scaffold_44:431753..431777 25/25 unknown
scaffold_44:440349..440373 25/25 unknown
scaffold_44:459683..459707 25/25 unknown
scaffold_44:46108..46132 25/25 Antisense off-target zfp2
scaffold_44:468537..468561 25/25 unknown
scaffold_44:473115..473139 25/25 unknown
scaffold_44:479727..479751 25/25 unknown
scaffold_44:488127..488151 25/25 Antisense off-target znf717
scaffold_44:497598..497622 25/25 unknown
scaffold_44:506409..506433 25/25 unknown
scaffold_44:305867..305891 25/25 unknown
scaffold_44:530591..530615 25/25 unknown
scaffold_44:537801..537825 25/25 unknown
scaffold_44:546818..546842 25/25 Antisense off-target zfp160
scaffold_44:560635..560659 25/25 Antisense off-target zfp160
scaffold_44:572868..572892 25/25 unknown
scaffold_44:579433..579457 25/25 unknown
scaffold_44:592463..592487 25/25 unknown
scaffold_44:59713..59737 25/25 Antisense off-target znf782
scaffold_44:610467..610491 25/25 unknown
scaffold_44:622737..622761 25/25 unknown
scaffold_44:631155..631179 25/25 unknown
scaffold_44:642485..642509 25/25 unknown
scaffold_44:653473..653497 25/25 unknown
scaffold_44:88025..88049 25/25 unknown
scaffold_4525:3264..3288 25/25 unknown
scaffold_4883:3241..3265 25/25 unknown
scaffold_497:21610..21634 25/25 unknown
scaffold_497:39601..39625 25/25 unknown
scaffold_525:21694..21718 25/25 Antisense target znf287
scaffold_44:516177..516201 25/25 unknown
scaffold_525:361..385 25/25 unknown
scaffold_525:43741..43765 25/25 Antisense target znf287
scaffold_525:53368..53392 25/25 Antisense target znf287
scaffold_5320:3179..3203 25/25 unknown
scaffold_5320:791..815 25/25 unknown
scaffold_659:17896..17920 25/25 unknown
scaffold_659:1855..1879 25/25 unknown
scaffold_659:34026..34050 25/25 unknown
scaffold_659:35722..35746 25/25 unknown
scaffold_680:12120..12144 25/25 Antisense off-target LOC100495155
scaffold_680:21500..21524 25/25 Antisense off-target LOC100495155
scaffold_684:25721..25745 25/25 unknown
scaffold_684:8489..8513 25/25 unknown
scaffold_6929:585..609 25/25 unknown
scaffold_6965:877..901 25/25 unknown
scaffold_6982:214..238 25/25 unknown
scaffold_7:9215231..9215255 25/25 unknown
scaffold_8431:3201..3225 25/25 unknown
scaffold_8c:3072594..3072618 25/25 Antisense off-target zscan29
scaffold_8c:3091216..3091240 25/25 Antisense off-target znf567
scaffold_525:33906..33930 25/25 Antisense target znf287
scaffold_4:81979702..81979726 24/25 unknown
scaffold_4:82220918..82220942 24/25 unknown
scaffold_44:599603..599627 24/25 unknown
scaffold_1:72753501..72753525 22/25 Antisense off-target sox13
scaffold_4:82251124..82251148 22/25 unknown
scaffold_1:196466473..196466497 21/25 Sense off-target bod1l1
scaffold_4:82223320..82223344 21/25 unknown
Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556