Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311510

Morpholino Name: zbed4 MO1
Synonyms: TEgg003g16, Xtznfp6
mRNA Target: zbed4

Morpholino Type:
Sequence:
5' TTCTTCAGCAAGATTACTTTCCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AATGGAAAGTAATCTTGCTGAAGAA 3' ||||||||||||||||||||||||| 3' TTACCTTTCATTAGAACGACTTCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold108224:473450-473474 22/25 Antisense off-target Xelaev16002129m
Scaffold166605:754880-754904 22/25 unknown
Scaffold21603:9629097-9629121 22/25 Sense off-target Xelaev16028006m
Scaffold278088:1230347-1230371 22/25 Antisense off-target Xelaev16038125m
Scaffold5732:9464725-9464749 21/25 unknown
tropicalis 7.1 scaffold_3:101060681-101060705 25/25 Antisense target zbed4
scaffold_2:108061864-108061888 21/25 Sense off-target spata13
scaffold_3:95621128-95621152 21/25 unknown
scaffold_737:5514-5538 21/25 Antisense off-target col9a1
scaffold_8:63004858-63004882 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556