Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311605

Morpholino Name: tacc1 MO1
Synonyms:
mRNA Target: tacc1

Morpholino Type: splice blocking morpholino (5' UTR)
Sequence:
5' ACTGCCCGTGTCACTCACCCAGACT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' AGTCTGGGTGAGTGCAATGGGCAGT 3' |||||||||||||| | ||||||| 3' TCAGACCCACTCACTGTGCCCGTCA 5' 5' AGTCTGGGTGAGTGACACGGGCAGT 3' ||||||||||||||||||||||||| 3' TCAGACCCACTCACTGTGCCCGTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125276393..125276417 25/25 Antisense off-target star.L
chr3L:125276393..125276417 25/25 Antisense target tacc1.L
tropicalis 10.0 Chr3:132044747..132044771 22/25 Antisense target tacc1
Chr2:1625156..1625180 21/25 Antisense off-target agpat3
Chr2:1625156..1625180 21/25 Sense off-target Xetrov107012241m.g
Publications
First: Xenopus TACC1 is a microtubule plus-end tracking protein that can regulate microtubule dynamics during embryonic development., Cytoskeleton (Hoboken) 2015            
Most recent:
View All Papers