Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311608

Morpholino Name: tacc3 MO2
Synonyms:
mRNA Target: tacc3

Morpholino Type: splice blocking morpholino
Sequence:
5' AGTTGTAGGCTCATTCTAAACAGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: TACC3 is a microtubule plus end-tracking protein that promotes axon elongation and also regulates microtubule plus end dynamics in multiple embryonic cell types., Mol Biol Cell 2014                                
Most recent: Wolf-Hirschhorn Syndrome-Associated Genes Are Enriched in Motile Neural Crest Cells and Affect Craniofacial Development in Xenopus laevis., Front Physiol 2019                            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556