Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311608

Morpholino Name: tacc3 MO2
Synonyms:
mRNA Target: tacc3

Morpholino Type: Splice Blocking()
Sequence:
5' AGTTGTAGGCTCATTCTAAACAGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: TACC3 is a microtubule plus end-tracking protein that promotes axon elongation and also regulates microtubule plus end dynamics in multiple embryonic cell types. [Mol Biol Cell 2014]
Most recent: The microtubule plus-end-tracking protein TACC3 promotes persistent axon outgrowth and mediates responses to axon guidance signals during development. [Neural Dev 2017]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556