Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326412

Morpholino Name: chrdl1 MO1
Synonyms:
mRNA Target: chrdl1

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence:
5' ATCGAAATGATATTACCTCTCGGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGCCGAGAGGTAATATCATTTCGAT 3' ||||||||||||||||||||||||| 3' ACGGCTCTCCATTATAGTAAAGCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:29642964..29642988 25/25 Antisense target chrdl1.L
Publications
First: Molecular mechanism of CHRDL1-mediated X-linked megalocornea in humans and in Xenopus model., Hum Mol Genet 2015  
Most recent:
View All Papers