Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326413

Morpholino Name: chrdl1 MO2
Synonyms:
mRNA Target: chrdl1

Morpholino Type: splice blocking morpholino (I1-E2)
Sequence:
5' CCACCCTGAAAGATAAATCTCACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24 23/24
genomic

MO
5' TGTGAGATTTATCTTTCAGGGTGG 3' |||||||||||||||||||||||| 3' ACACTCTAAATAGAAAGTCCCACC 5' 5' TGTGAGATTTATCTTTCAGGGTGG 3' |||||||||||||||||||||||| 3' ACACTCTAAATAGAAAGTCCCACC 5' 5' TGTGAGATTTATCTTTCAGAGTGG 3' ||||||||||||||||||| |||| 3' ACACTCTAAATAGAAAGTCCCACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:29641057..29641080 24/24 Antisense target chrdl1.L
chr8S:57409609..57409632 23/24 Antisense target chrdl1.S
chr2L:18714432..18714455 20/24 Sense off-target ncam2.L
chr6S:56378585..56378608 20/24 unknown
tropicalis 10.0 Chr8:51403870..51403893 24/24 Antisense target chrdl1
Chr1:169566917..169566940 20/24 unknown
Chr1:195511091..195511114 20/24 unknown
Publications
First: Molecular mechanism of CHRDL1-mediated X-linked megalocornea in humans and in Xenopus model., Hum Mol Genet 2015  
Most recent:
View All Papers