Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326551

Morpholino Name: yap1 MO6
Synonyms:
mRNA Target: yap1

Morpholino Type:
Sequence:
5' TAGGAGACTGTGGGTCACTTCACCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6290:749435-749459 25/25 Antisense off-target Xelaev16066665m
tropicalis 7.1 scaffold_7:8752817-8752841 21/25 Sense off-target ascc1
Publications
First: YAP controls retinal stem cell DNA replication timing and genomic stability. [Elife 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556