Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326554

Morpholino Name: smad1 MO2
Synonyms: miR-26 Target Protector
mRNA Target: smad1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTCTGACTCCTTCAAGTACATGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCATGTACTTGAAGGAGTCAGAC 3' ||||||||||||||||||||||||| 3' TACGTACATGAACTTCCTCAGTCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:46979535..46979559 25/25 Antisense target smad1.S
tropicalis 10.0 Chr2:147560594..147560618 21/25 Sense off-target tns2
Publications
First: Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1., Dev Biol 2016                  
Most recent:
View All Papers