Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326640

Morpholino Name: ets1 MO2
Synonyms:
mRNA Target: ets1

Morpholino Type: uncategorized morpholino
Sequence:
5' TCCTTCCAAATAGAGAAATGTGTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 25/25
genomic

MO
5' ACACACACCGCTCTATTTGGAAGGA 3' ||||||| ||||||||||||||| 3' TGTGTGTAAAGAGATAAACCTTCCT 5' 5' ACACACATTTCTCTATTTGGAAGGA 3' ||||||||||||||||||||||||| 3' TGTGTGTAAAGAGATAAACCTTCCT 5' 5' ACACACATTTCTCTATTTGGAAGGA 3' ||||||||||||||||||||||||| 3' TGTGTGTAAAGAGATAAACCTTCCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold166674:4678052..4678076 25/25 Antisense target ets1.L
Scaffold226594:1038620..1038644 25/25 Antisense target ets1.S
Scaffold111824:3955782..3955806 21/25 unknown
Scaffold13787:2030828..2030852 21/25 unknown
Scaffold155039:4565577..4565601 21/25 unknown
Scaffold195048:41073..41097 21/25 unknown
Scaffold26364:1865706..1865730 21/25 Antisense off-target Xelaev16035298m
Scaffold29769:1193193..1193217 21/25 unknown
Scaffold34527:747934..747958 21/25 unknown
Scaffold44494:2556566..2556590 21/25 unknown
Scaffold44546:1671444..1671468 21/25 unknown
Scaffold57180:455671..455695 21/25 unknown
tropicalis 7.1 scaffold_6:12045252..12045276 22/25 unknown
scaffold_7:87629624..87629648 22/25 Antisense target ets1
scaffold_9:37691898..37691922 21/25 unknown
Publications
First: The Proto-oncogene Transcription Factor Ets1 Regulates Neural Crest Development through Histone Deacetylase 1 to Mediate Output of Bone Morphogenetic Protein Signaling., J Biol Chem 2015                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556