Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326643

Morpholino Name: ets1 MO3
Synonyms: ets1MO2a
mRNA Target: ets1

Morpholino Type: uncategorized morpholino
Sequence:
5' TGAGATCTAGCGCAGCTTTCATGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25 25/25
genomic

MO
5' GCCATGAAAGCTGCGCTAGACCTTA 3' |||||||||||||||||||| || | 3' CGGTACTTTCGACGCGATCTAGAGT 5' 5' GCCATGAAAGCTGCACTAGACCTTA 3' |||||||||||||| ||||| || | 3' CGGTACTTTCGACGCGATCTAGAGT 5' 5' GCCATGAAAGCTGCGCTAGATCTCA 3' ||||||||||||||||||||||||| 3' CGGTACTTTCGACGCGATCTAGAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold226594:1038475..1038499 25/25 Antisense target ets1.S
Scaffold166674:4678196..4678220 22/25 Antisense target ets1.L
tropicalis 7.1 scaffold_7:87629763..87629787 23/25 Antisense target ets1
Publications
First: The Proto-oncogene Transcription Factor Ets1 Regulates Neural Crest Development through Histone Deacetylase 1 to Mediate Output of Bone Morphogenetic Protein Signaling., J Biol Chem 2015                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556