Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17327022

Morpholino Name: ttc29 MO1
Synonyms:
mRNA Target: ttc29

Morpholino Type: uncategorized morpholino
Sequence:
5' GTGCACTCATTCTCTTCAAGTTTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:68745786..68745810 21/25 Antisense off-target cdh6.S
tropicalis 10.0 Chr7:32783253..32783277 22/25 Antisense off-target LOC116412244
Publications
First: Coordinated genomic control of ciliogenesis and cell movement by RFX2., Elife 2014                                                    
Most recent:
View All Papers