Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17327067

Morpholino Name: fmn1 MO1
Synonyms: formin-1 MO
Target mRNA: fmn1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCAAAAATCGGTACATACCTTGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' AACAAGGTATGTACAGATTTTTGGA 3' |||||||||||||| |||||||||| 3' TTGTTCCATACATGGCTAAAAACCT 5' 5' AACAAGGTATGTACCGATTTTTGGA 3' ||||||||||||||||||||||||| 3' TTGTTCCATACATGGCTAAAAACCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:88154058..88154082 25/25 Antisense target fmn1.L
tropicalis 10.0 Chr8:110557597..110557621 24/25 Antisense target fmn1
Publications
First: The polarity protein Inturned links NPHP4 to Daam1 to control the subapical actin network in multiciliated cells., J Cell Biol 2015            
Most recent:
View All Papers