Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328085

Morpholino Name: aspn MO1
Synonyms: ASPN-MO1
Target mRNA: aspn

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ATTCCTTCATGGTGTTGTTTCAGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 23/25
genomic

MO
5' CTCTGAAACAACACCATGAAGGAAT 3' ||||||||||||||||||||||||| 3' GAGACTTTGTTGTGGTACTTCCTTA 5' 5' CTCTGAAACAACACCATGAAGGAAT 3' ||||||||||||||||||||||||| 3' GAGACTTTGTTGTGGTACTTCCTTA 5' 5' CCCTGAAACAGCACCATGAAGGAAT 3' | |||||||| |||||||||||||| 3' GAGACTTTGTTGTGGTACTTCCTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:117295263..117295287 25/25 Antisense target aspn.L
chr4S:97084261..97084285 23/25 Antisense target aspn.S
chr4L:117295263..117295287 25/25 Sense off-target cenpp.L
chr3S:83716992..83717016 21/25 Sense off-target pawr.S
chr8L:63087250..63087274 21/25 unknown
tropicalis 10.0 Chr4:124064042..124064066 25/25 Antisense target aspn
Chr4:124064042..124064066 25/25 Sense off-target cenpp
Chr2:137176197..137176221 21/25 unknown
Publications
First: The small leucine-rich repeat secreted protein Asporin induces eyes in Xenopus embryos through the IGF signalling pathway., Development 2015                                
Most recent:
View All Papers