Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328086

Morpholino Name: aspn MO2
Synonyms: ASPNb-MO2
Target mRNA: aspn

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' TATAATTCTGCGGATCATAGATAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTTATCTATGATCCGCAGAATTATA 3' ||||||||||||||||||||||||| 3' AAATAGATACTAGGCGTCTTAATAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:97084235..97084259 25/25 Antisense target aspn.S
chr2S:80490795..80490819 21/25 unknown
tropicalis 10.0 Chr7:85667483..85667507 21/25 Sense off-target htr3a
Publications
First: The small leucine-rich repeat secreted protein Asporin induces eyes in Xenopus embryos through the IGF signalling pathway., Development 2015                                
Most recent:
View All Papers