Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328087

Morpholino Name: aspn MO3
Synonyms: ASPNa-MO2
Target mRNA: aspn

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' TCTTCTTAACTGTAAATCCACCTGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:41465175..41465199 21/25 Sense off-target akap13.S
chr9_10L:24044694..24044718 21/25 Sense off-target ccdc57.L
chr1L:131622020..131622044 21/25 unknown
Publications
First: The small leucine-rich repeat secreted protein Asporin induces eyes in Xenopus embryos through the IGF signalling pathway., Development 2015                                
Most recent:
View All Papers