Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328099

Morpholino Name: rai1 MO1
Synonyms:
mRNA Target: rai1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACCTTTCCCGAAAAGACTGCATGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCCATGCAGTCTTTTCGGGAAAGGT 3' ||||||||||||||||||||||||| 3' CGGTACGTCAGAAAAGCCCTTTCCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15215:837134..837158 24/25 Antisense off-target Xelaev16015191m
Scaffold96766:129794..129818 24/25 Antisense off-target Xelaev16080035m
tropicalis 7.1 scaffold_9:84258098..84258122 25/25 Antisense target rai1
scaffold_9:11124941..11124965 22/25 unknown
Publications
First: Retinoic acid induced-1 (Rai1) regulates craniofacial and brain development in Xenopus., Mech Dev 2014                              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556