Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328100

Morpholino Name: rai1 MO2
Synonyms:
mRNA Target: rai1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGGATTTTTCTGCTCCTATAAGCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15215:837055..837079 25/25 Antisense off-target Xelaev16015191m
Scaffold120240:6649692..6649716 21/25 unknown
Scaffold32519:1334014..1334038 21/25 Sense off-target Xelaev16043136m
Publications
First: Retinoic acid induced-1 (Rai1) regulates craniofacial and brain development in Xenopus., Mech Dev 2014                              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556