Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328184

Morpholino Name: tal1 MO2
Synonyms: Scl MO2
mRNA Target: tal1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCTCCCCTCCTACTGACACTTTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GTAAAGTGTCAGTAGGAGGGGAGAT 3' |||||||||||||||||||||||| 3' CATTTCACAGTCATCCTCCCCTCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold69443:2586428..2586452 24/25 Antisense target tal1.S
Scaffold315413:1132432..1132456 22/25 unknown
Scaffold75417:7276176..7276200 21/25 Sense off-target Xelaev16072160m
Publications
First: VEGFA-dependent and -independent pathways synergise to drive Scl expression and initiate programming of the blood stem cell lineage in Xenopus., Development 2013                                                                                                                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556