Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328185

Morpholino Name: tal1 MO3
Synonyms: Scl MO3
mRNA Target: tal1

Morpholino Type: uncategorized morpholino
Sequence:
5' TCTCCATCATCTTTAGGGACATTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' CCTCTGTCCCTGAAGATGATGGAGA 3' | ||||||| ||||||||||||| 3' CGTTACAGGGATTTCTACTACCTCT 5' 5' GCAATGTCCCTAAAGATGATGGAGA 3' ||||||||||||||||||||||||| 3' CGTTACAGGGATTTCTACTACCTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold69443:2586392..2586416 25/25 Antisense target tal1.S
Scaffold135961:499916..499940 22/25 Antisense off-target elk1.S
tropicalis 7.1 scaffold_2:24485630..24485654 21/25 unknown
scaffold_3:33284894..33284918 21/25 unknown
scaffold_4:103812159..103812183 21/25 Antisense target tal1
Publications
First: VEGFA-dependent and -independent pathways synergise to drive Scl expression and initiate programming of the blood stem cell lineage in Xenopus., Development 2013                                                                                                                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556