Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328283

Morpholino Name: c21orf59 MO1
Synonyms: c21orf59 SPL MO
mRNA Target: cfap298

Morpholino Type: Splice Blocking()
Sequence:
5' TGGTGCTGCAAATAAACACACTCAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTGAGTGTGTTTATTTGCAGCACCA 3' ||||||||||||||||||||||||| 3' CACTCACACAAATAAACGTCGTGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6590:5928089..5928113 25/25 Antisense target c21orf59.L
Scaffold360703:132947..132971 22/25 unknown
Scaffold120240:6208430..6208454 21/25 Antisense off-target ccnyl1.L
Scaffold127590:404801..404825 21/25 Sense off-target ndor1.L
Scaffold133244:67511..67535 21/25 unknown
Scaffold24235:5796702..5796726 21/25 unknown
Scaffold251007:492944..492968 21/25 Antisense off-target Xelaev16033381m
Scaffold3881:2916540..2916564 21/25 Antisense off-target Xelaev16049646m
Scaffold41523:5441604..5441628 21/25 Antisense off-target Xelaev16052304m
Scaffold52573:3121930..3121954 21/25 Sense off-target Xelaev16060358m
Scaffold6875:704709..704733 21/25 Antisense off-target ccnyl1.S
tropicalis 7.1 scaffold_1:77433335..77433359 21/25 unknown
Publications
First: c21orf59/kurly Controls Both Cilia Motility and Polarization. [Cell Rep 2016]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556