Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328284

Morpholino Name: c21orf59 MO2
Synonyms: c21orf59 ATGMO1
mRNA Target: c21orf59

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' TGTAAGCGCACCATTTTTCCAATCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' TGATTGGAGAAATGGTGCGCTTACA 3' |||||||| |||||||||||||||| 3' ACTAACCTTTTTACCACGCGAATGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6590:5925707-5925731 24/25 Antisense target c21orf59.L
Scaffold6754:3342526-3342550 23/25 Antisense off-target Xelaev16068118m
Scaffold268711:305668-305692 21/25 Antisense off-target Xelaev16036356m
Scaffold5925:7521814-7521838 21/25 Antisense off-target c12orf45.S
Scaffold67832:177752-177776 21/25 Antisense off-target Xelaev16068359m
Publications
First: c21orf59/kurly Controls Both Cilia Motility and Polarization. [Cell Rep 2016]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556