Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328341

Morpholino Name: mapk15 MO1
Synonyms: erk7 MO
Target mRNA: mapk15

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTTCCACCTCTGGGCCACTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CATGAGTGGCCCAGAGGTGGAGGAT 3' ||||||||||||||||||||| ||| 3' GTACTCACCGGGTCTCCACCTTCTA 5' 5' CATGAGTGGCCCAGAGGTGGAAGAT 3' ||||||||||||||||||||||||| 3' GTACTCACCGGGTCTCCACCTTCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:154896771..154896795 25/25 Antisense target mapk15.L
chr3L:106072647..106072671 21/25 Sense off-target lrrc28.L
tropicalis 10.0 Chr6:154269856..154269880 24/25 Antisense target mapk15
Chr6:154269856..154269880 24/25 Antisense off-target Xetrov107045897m.g
Publications
First: ERK7 regulates ciliogenesis by phosphorylating the actin regulator CapZIP in cooperation with Dishevelled., Nat Commun 2015                  
Most recent:
View All Papers