Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328342

Morpholino Name: mapk15 MO2
Synonyms:
Target mRNA: mapk15

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGTCACACAACAACTGGCCCCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAGGGGCCAGTTGTTGTGTGACAT 3' ||||||||||||||||||||||||| 3' CCTCCCCGGTCAACAACACACTGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:154896796..154896820 25/25 Antisense target mapk15.L
chr8S:39952984..39953008 21/25 Sense off-target Xelaev18041808m
chr8S:39952984..39953008 21/25 Sense off-target Xelaev18041809m
chr8S:39955010..39955034 21/25 Sense off-target Xelaev18041810m
chr8S:39955010..39955034 21/25 Sense off-target LOC108700018 [provisional:prkcq]
chr8S:40484671..40484695 21/25 Sense off-target Xelaev18041826m
tropicalis 10.0 Chr10:10130964..10130988 21/25 Sense off-target gs17
Publications
First: ERK7 regulates ciliogenesis by phosphorylating the actin regulator CapZIP in cooperation with Dishevelled., Nat Commun 2015                  
Most recent:
View All Papers