Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328374

Morpholino Name: pou5f3.2 MO6
Synonyms:
mRNA Target: pou5f3.2

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTGTTGGCTGTACATGGTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/22 22/22 22/22
genomic

MO
5' GACACTATGTACAGCCAACAGC 3' ||||| |||||||||||||||| 3' CTGTGGTACATGTCGGTTGTCG 5' 5' GACACCATGTACAGCCAACAGC 3' |||||||||||||||||||||| 3' CTGTGGTACATGTCGGTTGTCG 5' 5' GACACCATGTACAGCCAACAGC 3' |||||||||||||||||||||| 3' CTGTGGTACATGTCGGTTGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:2141734..2141755 22/22 Antisense target pou5f3.2.L
chr8S:27463659..27463680 22/22 Antisense target pou5f3.2.S
chr1L:16281188..16281209 19/22 Sense off-target acox3.L
chr8S:36286431..36286452 19/22 Antisense off-target pnck.S
chr8S:36286431..36286452 19/22 Sense off-target ccnq.S
chr5L:146841788..146841809 18/22 Antisense off-target ptchd4.L
chr5L:2004547..2004568 18/22 Sense off-target ccdc88a.L
chr6L:109974984..109975005 18/22 Antisense off-target znf521.L
tropicalis 10.0 Chr8:3291024..3291045 21/22 Antisense target pou5f3.2
Chr9:35740012..35740033 19/22 Antisense off-target mrtfb
Chr4:131901601..131901622 18/22 Sense off-target ift122
Chr7:112652933..112652954 19/22 unknown
Chr2:133445963..133445984 18/22 unknown
Publications
First: Genome-wide view of TGFβ/Foxh1 regulation of the early mesendoderm program., Development 2014                                    
Most recent:
View All Papers