Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328442

Morpholino Name: hbg1 cMO1
Synonyms: Hsa.beta-globin intron mutation, Mutant B-globin, control morpholino
mRNA Target: hbg1

Morpholino Type: control morpholino
Sequence:
5' CCTCTTACCTCAGTTACAATTTATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106356:1229541..1229565 21/25 Antisense off-target Xelaev16001542m
Scaffold12518:11795189..11795213 21/25 unknown
Scaffold149890:4288013..4288037 21/25 unknown
tropicalis 7.1 scaffold_3:14279218..14279242 21/25 Sense off-target adam21
scaffold_6:104501985..104502009 21/25 unknown
Publications
First: Developmental role of plk4 in Xenopus laevis and Danio rerio: implications for Seckel Syndrome., Biochem Cell Biol 2015    
Most recent: Microsyntenic Clusters Reveal Conservation of lncRNAs in Chordates Despite Absence of Sequence Conservation., Biology (Basel) 2019              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556