Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328496

Morpholino Name: nog4 MO2
Synonyms: Noggin4 MO2
mRNA Target: nog4

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' GATTATAGAAGTGAGTATCTTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold78978:5447059..5447083 22/25 Antisense off-target Xelaev16073705m
Scaffold104110:605103..605127 21/25 unknown
tropicalis 7.1 scaffold_7:37415569..37415593 21/25 unknown
Publications
First: Noggin4 is a long-range inhibitor of Wnt8 signalling that regulates head development in Xenopus laevis. [Sci Rep 2016]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556