Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328510

Morpholino Name: Igfbp4 MO1
Synonyms: xigfbp-4 (Mo-s), xigfbp4
mRNA Target: igfbp4

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' ATGTCTGGATATTGCCACCCTGCCCTTTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 28/30
genomic

MO
5' CAAAAGGGCAGGGTGGCAGTTTCCAGACAT 3' |||||||||||||||||| | ||||||||| 3' GTTTTCCCGTCCCACCGTTATAGGTCTGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:3431188..3431217 30/30 Sense off-target Xelaev16009351m
Scaffold75417:6374454..6374483 29/30 Sense off-target Xelaev16072086m
tropicalis 7.1 scaffold_10:32326374..32326403 28/30 Sense target igfbp4
Publications
First: IGFBP-4 is an inhibitor of canonical Wnt signalling required for cardiogenesis., Nature 2008                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556