Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328554

Morpholino Name: vangl2 MO4
Synonyms:
mRNA Target: vangl2

Morpholino Type:
Sequence:
5' GAGTACCGGCTTTTGTGGCGATCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 25/25
genomic

MO
5' TGGAACGGCACAAAAGCCGCTACTC 3' |||| || ||||||||||| ||||| 3' ACCTAGCGGTGTTTTCGGCCATGAG 5' 5' TGGATCGCCACAAAAGCCGGTACTC 3' ||||||||||||||||||||||||| 3' ACCTAGCGGTGTTTTCGGCCATGAG 5' 5' TGGATCGCCACAAAAGCCGGTACTC 3' ||||||||||||||||||||||||| 3' ACCTAGCGGTGTTTTCGGCCATGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold226:554583-554607 25/25 Antisense target vangl2.L
Scaffold41091:2015269-2015293 25/25 Antisense target vangl2.S
tropicalis 7.1 scaffold_8c:2756782-2756806 22/25 Antisense target vangl2
Publications
First: The involvement of PCP proteins in radial cell intercalations during Xenopus embryonic development. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556