Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328568

Morpholino Name: daam1 MO2
Synonyms: daam1 MO
mRNA Target: daam1

Morpholino Type:
Sequence:
5' GGCCATGGCCGCAGGTCTGTCAGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 24/25
genomic

MO
5' AACTGACAGACCTGTGGCCATGGCG 3' |||||||||||||| ||||||||| 3' TTGACTGTCTGGACGCCGGTACCGG 5' 5' AACTGACAGACCTGTGGCCATGGCC 3' |||||||||||||| |||||||||| 3' TTGACTGTCTGGACGCCGGTACCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45985:918553-918577 25/25 Antisense off-target Xelaev16055635m
Scaffold133644:827587-827611 24/25 Antisense target daam1.S
tropicalis 7.1 scaffold_8:82035109-82035133 23/25 Antisense target daam1
Publications
First: Vangl2 cooperates with Rab11 and Myosin V to regulate apical constriction during vertebrate gastrulation. [Development 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556