Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328744

Morpholino Name: sall4 MO1
Synonyms:
mRNA Target: sall4

Morpholino Type:
Sequence:
5' GCCAATTATTCCCTTTCTCCACCAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GTGGTGGAGAAAGGGAATAATTGGC 3' ||||||||||||||||||||||||| 3' CACCACCTCTTTCCCTTATTAACCG 5' 5' GTGGTGGAGAAAGGGAATAATTGGC 3' ||||||||||||||||||||||||| 3' CACCACCTCTTTCCCTTATTAACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14557:3903180-3903204 25/25 Antisense off-target Xelaev16013262m
Scaffold2511:1598581-1598605 25/25 Antisense target sall4.L
Scaffold123719:2001434-2001458 22/25 unknown
tropicalis 7.1 scaffold_10:13911538-13911562 25/25 Antisense target sall4
scaffold_6:117548599-117548623 22/25 Sense off-target malrd1
Publications
First: Spalt-like 4 promotes posterior neural fates via repression of pou5f3 family members in Xenopus. [Development 2014]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556