Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328748

Morpholino Name: myh9 MO1
Synonyms: myosin IIA
mRNA Target: myh9

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTTGTCCACATCTGTTTGTGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGCACAAACAGATGTGGACAAGT 3' ||||||||||||||||||||||||| 3' TACCGTGTTTGTCTACACCTGTTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold245044:6968399..6968423 25/25 Antisense target myh9.L
Scaffold75398:1117080..1117104 21/25 Antisense off-target ddx39b.L
tropicalis 7.1 scaffold_7:49670127..49670151 21/25 unknown
scaffold_8:59430222..59430246 21/25 unknown
Publications
First: An adhesome comprising laminin, dystroglycan and myosin IIA is required during notochord development in Xenopus laevis., Development 2014                        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556