Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328893

Morpholino Name: lhx2 MO1
Synonyms: lhx2 i2e3
mRNA Target: lhx2

Morpholino Type: splice blocking morpholino
Sequence:
5' ATCGCCTGTGCAATCAGAACCAGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' TCCTGGTTCTGATTGCACAGGCGAT 3' ||||||||||||||||||||||||| 3' AGGACCAAGACTAACGTGTCCGCTA 5' 5' TCCTGGTTCTGATTGCACAGGCGGT 3' ||||||||||||||||||||||| | 3' AGGACCAAGACTAACGTGTCCGCTA 5' 5' TCCTGGTTCTGATTGCACAGGCGGT 3' ||||||||||||||||||||||| | 3' AGGACCAAGACTAACGTGTCCGCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:9369231..9369255 24/25 Antisense target lhx2.L
chr8S:41364561..41364585 24/25 Antisense target lhx2.S
chr2L:104877701..104877725 21/25 unknown
tropicalis 10.0 Chr8:29552100..29552124 25/25 Antisense target lhx2
Chr6:92393142..92393166 21/25 Sense off-target jarid2
Publications
First: Fezf2 promotes neuronal differentiation through localised activation of Wnt/β-catenin signalling during forebrain development., Development 2014                              
Most recent:
View All Papers